jueves, 29 de noviembre de 2007

Acción Social

Enviado por Fernanda Flores



39 comentarios:

Blog Gas del Estado dijo...

Muchas gracias Fernanda. Estos son verdaderos documentos históricos!

Anónimo dijo...

Que belleza, yo no sabia de todo esto, me encanto, hace tanto que no podia entrar y encontrarme con tanta dulzura me encanto.
Es cierto Chiki....QUE HISTORIA!!!
Gracias
Cris Ll

Anónimo dijo...

Hola a Todos, y en especial a Fernanda: la verdad es que me emocioné muchisimo al leer las canciones de los centros de vacaciones felices... realmente fueron FELICES.
Les cuento que yo viví y tengo muchisimos recuerdos lindisimos de las vacaciones felices, más que del Club de Tigre... y gracias a eso hoy sigo teniendo contacto con mi amiga Valeria, que habia perdido el rastro pero nos reencontramos gracias al Blog.
Ella vive en Bariloche actualmente, y no entendiamos nada cuando nos volvimos a hablar por telèfono y cuando le contaba todo este movimiento generado por Chikito. Me encantaria poder encontrar a más compañeros de aquellas vacaciones, ya que no todos frecuentabamos el Club.
Y lo más lindo es que era gente de TODA la Argentina, porque recuerdo que iban de muchas provincias...
MUCHAS GRACIAS DE NUEVO!!!
Roxana Navia - 1974

Laura Mattioni dijo...

Fernanda: precioso recuerdo te guardaste todos estos años!!
Con el correr del tiempo, se me fueron perdiendo los que tenía.
Ese cancionero! Buenísimo!!
Yo también, como Roxana, tengo más recuerdos de la colonia que del club de niños, (donde odiaba anotarme, lamento decir, aunque a veces no podía zafar).
Pero a las colonias fui a todas, y encontré amigos de esos que se te quedan a vivir en el corazón.
Uno de ellos era del club, Jorge Tizzón, pero todavía no apareció por el blog.
Estaría bueno ubicarlo, pero no sé como...
(S.O.S. Luciano Palermo!!)

Un recuerdo espectacular; es cierto, es un documento histórico.
Gracias por compartirlo.

besos
Laura Mattioni

Anónimo dijo...

Y después dicen que Florio y García Belsunce (padre)ó Félix Luna, o Pigna, son los grandes historiadores argentinos...andaaaaaaaaa.....
Ésta es la verdadera historia, la historia en los documentos!!!!!!!!
Una mención de honor a F.F.
Abrazos.
Martín B.

gigio dijo...

ayy Carito que lastima porque el viernes no estamos.igualmente se nos hace dificil encontrarnos si andas ESCONDIDA.jajajajaja.Ves que tengo humor.Un beso y hasta la proxima escapada

gigio dijo...

Encima la ultima vez me despreciaste la torta y con Andy la tuvimos que comer aunque no podiamos.nos daba lastima tirarla jaja.Ahora no vengas a pedir masitas querida

Anónimo dijo...

Soy Gaby LL:

Laurita Mattioni, compartimos unas cuantas vaca feliz...te acordas cual??????????

Me cuesta, los años no vienen solos.

Los del 69, fuimos a Los Cardales, Conesa, Mar del Plata, Bariloche y Salta.¡¡¡BUENISIMOOO!!!!!!!

Chikito...te acordas cuando me tiraste NARANJU desde la ventana del micro que nos llevaba a los partidos???????

te voy a reventar. Eso si me acuerdo
Besitos millllll

MARCAS EN LA PIEL dijo...

GUAUUUUUUUUUUUUU!!! què maravilla la historia, no? Què manera de pensar en lo demàs!!!! guauuuuuuauuuauuauauuuuaaaaaaa uuuuu..no lo puedo creer. Por suerte hay gente que junta papeles ya saben para què..
gracias Hna. Fernanda !!!!!!!

Laura Mattioni dijo...

Gaby Ll:
Fuimos juntas a Conesa, con Nancy y Marcela.
estábamos en la habitación con una Katy, que lloraba todas las noches!
Teníamos una enorme libélula de mascota, no me acuerdo el nombre, pero era con las iniciales de las cuatro.
Nos robábamos pan del comedor para llevarle a unas gallinas que había en un gallinero por ahí cerca...

Y mil anécdotas más!!!
Nunca me las voy a olvidar!

Besos!
Laura Mattioni

Anónimo dijo...

Hola a Todos!!
Ni yo puedo creer lo que ha conservado mi hermana, francamente un lujo.
A Fer le gusta guardar cosas pero nunca imaginé que semejante tesoro.
Hace poquito me compartió que lo tenía, se lo mandó al Chiki y él, como siempre, aquí lo ha publicado.
Además de las canciones, si pueden lean las reglas de conducta que impartían "........no sacar los brazos por las ventanillas..." que bárbaro por Dios!!!
Señor, señor, no sea mal educado
sáquese el sombrero cuando pasa Gas del Estado.
Gracias nuevamente Chiki
Por mi hermana y por todos los colonos HIP-HIP RAAAAAAAAAA
Marcela Flores

Anónimo dijo...

Alguien se acuerda exactamente donde se hacian las vacaciones felices en Tandil?Era en un destacamento o eso era en Parque Camet(Mardel)? Ayuda por favor!!
Dario Sciammarella

Marce Albanese dijo...

Hola Tanito!!
Yo a Tandil no fui, pero lo del destacamento era Mardel, segurísimo.
El otro día "lo" y "te" recordábamos con Laura Mattioni. Ahora bien, por qué o cómo "te" recordábamos, aun no lo vamos a decir ...
saludos

bea dijo...

Dr Sciamarella

Dice mi marido que en Camet se hacía en el GADA 601, estaban todos los grupos juntos y el Dire era Rubén Corti. Mi marido supervisaba y yo con los cuatro hijos, en una casita en Santa Clara, hasta que llegaba a la noche.
También en Mardel, antes se hizo en El Sosiego, a la entrada de Mar del Plata sobre la Ruta 2. Un paraje precioso con pileta de natación cubierta, ¿te acordás?

bea dijo...

Fernanda Flores

Como dice Chikito, son verdaderos documentos históricos, los que enviaste al blog.
Leyendo con mi marido (cuando los agrandamos), recordamos que el trabajo en equipo, dio como fruto ese año, no sólo el cuadernillo que recibió cada colono y fue armado entre otros por el Prof. Fernando Barrios, sino la primera experiencia de traslados en avión para aprovechar mejor el tiempo en cada Centro, sin los largos viajes que debían afrontar algunos grupos para llegar a destino.
Ese año se realizaron cinco contingentes, lo que determinó un incremento en la cantidad de hijos de agentes que se movieron por todo el país, en ese verano para disfrutar, como lo menciona Laurita Mattioni.
Esfuerzo de un EQUIPO bien armado (en el que estaba mi marido), con bases criteriosas, en los que cada papá, se sentía orgulloso de pertenecer a la Empresa, porque sentía "cuidados" a sus hijos hasta en la manejo de los viajes en avión charteados por la gente de Gas que estaba en Relaciones Humanas.
Todo un "adelanto" de un "adelantado".
Besos

Laura Mattioni dijo...

Tanito!!
Como bien dice Marce, nos acordamos de vos.
Estuvimos juntos en Mascardi, donde me enseñaste a hacer una cruz tejida con hilo, te acordás?

besos

(todavía tenés el collar de mostacillas negro y amarillo?)

Carito dijo...
Este comentario ha sido eliminado por el autor.
Carito dijo...

Gigo, no ando ESCONDIDA, es q el otro dia me vieron in fraganti, nada del otro mundo vio...Y yo no desprecie la torta si hasta comi una porcion. Eso si, la semana que viene vas a ver lo que es una torta de ricota caserita y una pastafrola de membrillo y batata, todo lo hago yo!...

Marcas en la piel, podrias pasarme tu dire de mail a mi casilla, mandame un mail a carito.fortes@gmail.com q no lo tengo.
Gracias....

Carito dijo...

Ahhh y para Fer, buenisimo post, marce ya me lo habia pasado, hasta lo imprimi y lo guarde como reliquia, es genial poder compartirlo!
Yo de chiquita era de extrañar mucho y por eso no fui a muchas vacaciones felices, solo a medanos, y a entre rios, pero de las dos tengo maravillosos recuerdos....
Yo mas que mosquito de verano era mosquito de invierno....a mi me veian mas en esa epoca q en la de verano....

Anónimo dijo...

Hola Gente
Hoy primero de diciembre va un saludos especial a mi vieja amiga ÑA MARTA NOVO....dale timida que se vea que se vea.FELIZ CUMPLE LOCA....un super abrazo


Y en Tandil creo que la colonia era en una base de Gas del Estado y dormiamos en unos chatones de a cuatro, mi grupo era el de Rafa Garcia, Manolo, Sergio Magoo,y....me fallo la renga..
Besos
Cris Ll.

Che Gaby como asi que se te movio el rodete con los años...??

luciano palermo dijo...

FELIZ CUMPLE HERMANO LEANDRO PALERMO!!!!
QUIEN QUIERA SALUDARLO O MENSAJEARLO!
0294415635467
TE RE QUIERO !!!!!!

Anónimo dijo...

Cris Ll, dormias con esos tres delincuntes? No sabia que podia ser mixto el asunto...
EB

felipe dijo...

Un beso enorme a mi "prima Marta" y a Leandro por sus cumpleaños.

Tandil....quedaba en Tandil. No en parque Camet. Ese era otro destino.

Bea;
Entendí mal o el Melenprofe tambien "manejaba los aviones"Un capo ese piloto!!!!!!!!

Laura:
Me llegó la factura telefónica y he decidido NO LLAMARTE MAS. Guacha , te llamo por alguna boludez, y no paras de hablar, El 80% de los pulsos son a tu casa.
De ahora en mas por telegrama. Así cerras un poco el pico.
Dale un beso a MI AMIGO el Rolo.
Ahhh! otra cosa: en el asado de anoche te morfaste todo. En un momento estuvimos pensando en salir a comprar pizzas pensando que no nos dejabas nada.
Y terminando.....muy rico el Daikiri!!! TONTA LLEVASTE LA LICUADORA Y TE OLVIDASTE EL ANANÁ.
Te dije que cambies de locologo

melenprofe dijo...

Y bueno... nombraron VACAFELI y no puedo quedar impasible.

Por donde empezar..., el comienzo ya lo leyeron en las primeras páginas del blog y en los increíbles documentos que presiden éste comentario.

Arranco con el recuerdo de los "mentores", EDWIN KARLSSON que fué uno de los dos "profes" invitados por LAIÑO para empezar todo.

Luego, la necesidad de dar "ocupación del tiempo libre" a las familias que vivían en los Barrios de Viviendas, provocó la necesidad de contratar profesores de Educación Física casados con Maestras Jardineras (rara mezcla ¿No?) y allí aparecieron el "ciego" FERREYRA para Chelforó MANOLO SANCHEZ y su entrerriana esposa Gloria para Conesa y en Médanos, uno de Burzaco, ATILIO ETCHEZAR y su esposa Marta.

Como el Barrio de Viviendas tenía instalaciones de sobra (las "gamelas", unas pequeñas hosterías con habitaciones baños y cocina comedor destinadas al personal soltero) se generó allí la idea-posibilidad de Colonias de Vacaciones. ¿Y quienes las dirigirían? Pues los profesores mencionados.

Viaje al Inef de San Fernando a buscar profes varones y al "Romero Brest" de Republiquetas para encontrar "profas", y allí aparecieron los primeros equipos de trabajo.

Menciono a mis compañeros de "MEDANOS 61", ya que los otros "centros" se me borronean en la memoria.

Director y Jefe de Barrio: ATILIO ETCHEZAR.
Vicedirector, responsable de la contratación de los profesores:
GUSTAVO MORALES (riójano, así, con esdrújula).
Ellas: YOLANDA ESTARELLAS, MARTA RUIZ DE ERENCHUN, secundadas por tres maestras: Marta (esposa del dire) Pichi y ... Etchepareborda.
Ellos: MIGUEL BARCELÓ, RODOLFO BLANCO y el que escribe.

Recibimos tres contingentes provenientes de TODO el país, con edades entre 7 y 12 años GRUPOS MIXTOS con un 50 % de Buenos Aires y una sola zona que le hacía sombra MENDOZA y que los profes teníamos que tener muy en cuenta.

Testigos de esto, en el encuentro de 27/10/07, las hermanas PONTE, colonas de esa primer experiencia en "MedAJOS" (por el cultivo preponderante de la zona).

Claro que esto da para mucho más, ya se me están desuntemeciendo lo dedos y comenzaré la HISTORIA DE UNA VACA... DE VERANO. ¿Chikito..., me la publicarías?

Afectuosamente: Carlos Meléndez

Anónimo dijo...

Me sumo a lo dicho por Felipe: ¡¡ Que rico el Daikiri Laura !!!
Igual te queremos, Kudo.

Anónimo dijo...

que rico el asado lauri...

a.t.

Anónimo dijo...

Aclarenmé, porque le dicen "Ñoqui" al ñoqui ?????
es por lo que yo pienso ???

Daniel "Kudo" Peralta dijo...

Gracias Oscar y Laura por organizar el asadito, y a los demás por estar.
Un beso les manda la flia Peralta

Laura dijo...

Lauri y Oscar:
Nos encanto el encuentro de anoche!
Gracias a todos los concurrentes!!, pero te pido..., trata en la proxima de NO avisarle a un tal Felipe, si a mi amiga VIVI.
Ese guacho me anda calumniando e injuriando.Lo de la licuadora, es cierto.., lo de el anana, tambien.., ME LO OLVIDE!!, pero con todo lo q hablo.., no puede andar diciendo que comi mucho!!
Besos a todos!!!.., menos al Felipe ese....
Laura Ibañez.

Marta dijo...

Gracias Cristi y Felipe por los deseos ha sido uno de los años mas felices de mi vida!!! Reencontrarme con Uds. fue hermoso recuperar afectos pasados el mejor regalo que pudiera haber recibido en este cumple.- Mil gracias!!! Los quiero!!!

Anónimo dijo...

Estebankito
No mansilles mi nombre con calumnias tan impropias que soy una señora hecha.... lo de derecha y lo perdi hace unos años.....Esos hombres, hoy; unos niños ayer, han sido unos caballeros siempre, pero si de escapadas nocturnas, queres saber, en las VACA FELI del Melen Profe y compañian podemos charlar las de Chimocho en Las Grutas o mis primas (Hnas Garcia Cardenas) cuando andaban por Bariloche en los grupos grandes de 17 o 18 años, Bariloche, Las Pirquitas (ellas si hablaban de unos descontroles!!PUFFF) algunos de los de esa epoca que nos digan si es verdad, para ampliar la historia vio???...que cuenten
Vamos, vamos no sean timidos ahora...
Besos Cris Ll.

Daniela Frías dijo...

La primera vez que fui a Vacaciones Felices tenía 5 años y cumplí los 6 allá (el 11 de enero).
Mis viejos le habían dado un regalo a los profes.
Ahora, después de casi 34 años, tengo la imagen re clara de ese momento.
A Médanos después me tocó ir 2 veces mas. ¡Me lo conocía de memoria!
Me acuerdo de las casas donde vivíamos, de una cancha como de paleta, de la pile...
También fui a Mardel a los 2 lugares que dice BEA, a El Sosiego primero y después al GADA 601 (con Majo Giovannetti, Vero Zotta, Marcelo Soria, Tato Rivas de Mascardi, etc.).
¡Qué increible de tan chiquitos pasarse 15 días lejos de tu casa!
¡Cuánta independencia que nos dió!
Besos a todos.
Dani F.

felipe dijo...

Laura:
Me acabo de enterar que tambien olvidaste el Ron.
Para que llevaste la licuadora? Nos la querias vender?

Laura dijo...

RON!!!! RONQUE HASTA LAS CINCO DE LA TARDE CON EL DAIKIRI Q NOS TOMAMOS CON EL CACHI EN CASA. BOBO!!!!!
LA BOTELLA Q LLEVAMOS ERA DE VODKA!
AUNQ NO ME HABLES MAS POR TELEFONO... TE DIJE Q TE QUIERO???

Fernanda Mariela Flores dijo...

FERANANDA FLORES - GRACIAS A TODOS POR LOS COMENTARIOS, LENADRO Y LUCIANO PALERMO, CONOZCO MAY Y NOS REENCOTRAMOS SIN QUERER EN EL 2004, AL DIA DE HY SIGO EN COTACTO... POR OTRO LADO... LES TIRO ALGUANS IMAGEENS QUE QUE ME HAN QUEDADO FOTOGRAFICAMENTE... EL KIOSCO DONDE COMPRABAMOS LOS NARANJU, LAS MIELSITAS GUAU.. O PALITOS ANTES DE ETRAR AL CLUB; LA FIGAZA GRANDE DE LOMITO U QUESO CON LA BOTELLA DE PEPSI O TEEN SI TE TOCABA CUADRADO ERA MUJER Y REDONDO VARON EN EL RICON DE MILBER A LAS 17:15 + O -; SER EL 2º TURNO PARA ALMORZAR Y CORTARLE A LOS MAS PEQUEÑOS, SOLO LLEGUE HASTA PEJERREY Y NO PASE MAS POR QUE JAMAS ME TIRE DEL TRAMPOLIN...AMABA QUEDARME LOS SABADOS A DORMIR, LAS FIESTAS DE DISFRACES.... Y QUE ME TOCARA EL COLOR VERDE PARA CUALQUEIR TORNEO DE HANDBALL, DE VOLEY... O FUTBOL; CRUZAR DESDE EL VESTUARIO DE LA CANCHA DE FOTBOL HASTA LA PILETA CON OJOTAS LLENAS DE PASTO... DEL OLOR A COMIDA MIENTRAS SE JUGABA E LAS CACHAS ATRAS DEL COMEDOR..
SI ALGUIEN ME HUBIERA DICHO QUE OR LA PEURTA DE LA MUNICIPALIDAD DE VICENTE LOPEZ POR DODE PASO EL MICRO DURATE TANTOS AÑOS YO IVA A TRABAJAR NUNCA LO HUBIERA CREIDO... PERO SI... NO ME VEGA CON LA COMUNIDAD MOVISTAR... ESTOS ES RELMENTE UNA COMUNIDAD. BESOS Y HASTA PRONTITO... VISTE MARCE ACA ESTA MI COMETARIO....

FERNANDA FLORES dijo...

PERDON por mi redaccion y sintaxis...
sory MARCE... ,,, jajajajaja besos a todos

Anónimo dijo...

Muy bien cuñada, te felicito!!! No podías habernos dejado el legado que guardaste durante tanto tiempo, sin escribir un mísero comentario...!!!
Ahora eso si, para el próximo que hagas, sacate los mitones!!!
Besos y abrazos
Beto

Anónimo dijo...

Te quiero con o sin redacción.
Tu hermana.
Marcela Flores

Anónimo dijo...

Impresionante Daniela como te acordaste de Tato Rivas.El y su hermana Tati eran dos fenomenos.Yo los encontraba siempre en Miramar
El Tano